dde272c4b8
i18n - Build Validation / Validate i18n Builds (24) (push) Has been cancelled
CI - Node.js / Lint (24) (push) Has been cancelled
CI - Node.js / Build (24) (push) Has been cancelled
CI - Node.js / Test (24) (push) Has been cancelled
CI - Node.js / Test - Upcoming Changes (24) (push) Has been cancelled
CI - Node.js / Test - i18n (italian, 24) (push) Has been cancelled
CI - Node.js / Test - i18n (portuguese, 24) (push) Has been cancelled
CD - Docker - GHCR Images / Build and Push Images (push) Has been cancelled
73 lines
1.6 KiB
Markdown
73 lines
1.6 KiB
Markdown
---
|
|
id: 68d30845cc08266018fc46bc
|
|
title: "Challenge 76: Complementary DNA"
|
|
challengeType: 29
|
|
dashedName: challenge-76
|
|
---
|
|
|
|
# --description--
|
|
|
|
Given a string representing a DNA sequence, return its complementary strand using the following rules:
|
|
|
|
- DNA consists of the letters `"A"`, `"C"`, `"G"`, and `"T"`.
|
|
- The letters `"A"` and `"T"` complement each other.
|
|
- The letters `"C"` and `"G"` complement each other.
|
|
|
|
For example, given `"ACGT"`, return `"TGCA"`.
|
|
|
|
# --hints--
|
|
|
|
`complementary_dna("ACGT")` should return `"TGCA"`.
|
|
|
|
```js
|
|
({test: () => { runPython(`
|
|
from unittest import TestCase
|
|
TestCase().assertEqual(complementary_dna("ACGT"), "TGCA")`)
|
|
}})
|
|
```
|
|
|
|
`complementary_dna("ATGCGTACGTTAGC")` should return `"TACGCATGCAATCG"`.
|
|
|
|
```js
|
|
({test: () => { runPython(`
|
|
from unittest import TestCase
|
|
TestCase().assertEqual(complementary_dna("ATGCGTACGTTAGC"), "TACGCATGCAATCG")`)
|
|
}})
|
|
```
|
|
|
|
`complementary_dna("GGCTTACGATCGAAG")` should return `"CCGAATGCTAGCTTC"`.
|
|
|
|
```js
|
|
({test: () => { runPython(`
|
|
from unittest import TestCase
|
|
TestCase().assertEqual(complementary_dna("GGCTTACGATCGAAG"), "CCGAATGCTAGCTTC")`)
|
|
}})
|
|
```
|
|
|
|
`complementary_dna("GATCTAGCTAGGCTAGCTAG")` should return `"CTAGATCGATCCGATCGATC"`.
|
|
|
|
```js
|
|
({test: () => { runPython(`
|
|
from unittest import TestCase
|
|
TestCase().assertEqual(complementary_dna("GATCTAGCTAGGCTAGCTAG"), "CTAGATCGATCCGATCGATC")`)
|
|
}})
|
|
```
|
|
|
|
# --seed--
|
|
|
|
## --seed-contents--
|
|
|
|
```py
|
|
def complementary_dna(strand):
|
|
|
|
return strand
|
|
```
|
|
|
|
# --solutions--
|
|
|
|
```py
|
|
def complementary_dna(strand):
|
|
complements = { "A": "T", "T": "A", "C": "G", "G": "C" }
|
|
return "".join(complements[n] for n in strand)
|
|
```
|